                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCTCATCTCTTCCTCCACCGCTGGCGCCTTTTGCCTTAAAGCCCGCCCCAACCCCTG
AGCGGATTGCTTTTCGGGACATGCCCTCAAGCCATATCCGCCCTGAATTCCTGTTTTC
ACGCAATTCCGGCGAAACACgggttcccgtgtttctggaatttttccaaagtgcaccttgcgcccttttcgtcaagtggtaaatc
gtttttaccacttctgcacgtgctaaacagtttctccgtccgtgcatcaatcgacttgcacagcctgctgcccgcacgctagagcttagtctggccggaG
TG

    BMEII1065 Gene: BMEII1065     GI: 17989410     BI number: BMEII1065     GOG: COG0583     Description: TRANSCRIPTIONAL REGULATORY PROTEIN, LYSR FAMIL   A T  T A  C C  C CG GC |  C A  C AT CG TA C  A C  T C  | G  | T  |       AT A  |      A  T C  |      C  C       tt AT        GC       g  c GC        CG        gc GC       A  G       gc GT       C  C       Cg CG        TG        At |  T       TA        Cg |  T       TA        At |  T       TA        At T  T       GC        At T  C       TA        Gc T  A      C  C      C  | T  C       Cg       G  | CG        Tg        Gt GC        Tg        Cg TA        At        Cg TA        At        Ta AT        Gc        Ta                         tttttccaaagtgcaccttgcgcccttttcgtcaagtggtaaatcgtttttaccacttctgcacgtgctaaacagtttctccgtccgtgcatcaatcgacttgcacagcctgctgcccgcacgctagagcttagtctggccggaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................