                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCGGCAAGCTGGCGCGTGGCGAAAGGGGCCGCTATGGCGTGTTCCAGAGAGACGAC
CGTTATCCCGTCGAGAGGGCGGAGGGCGCTTTCTGGCGGCTGGACTGAGAAGGGTGCA
GTCATggcgtatatgctccggcttgaaaatttgaatgatgaaaatctaaaatattttcagcaaaagcgcgaagcggtgttcggcttccatttgacga
attaaaccttgaccgcgtgcggatgaccatgcgcatttttaaaaggaagccttcgctaaaattgaaggctggtccaggagactgtccATG

    BMEII1077 Gene: BMEII1077     GI: 17989422     BI number: BMEII1077     GOG: COG0583     Description: TRANSCRIPTIONAL REGULATORY PROTEIN, LYSR FAMIL            ca           c  t           t  t           t  t           c  g           g  a            gc            cg            ta            ta            gt           |  t           |  a           |  a           |  a           |  c           |  c           |  t           |  t           |  g            ta            gc            gc            cg            gc           a  |           a  |           g  |            cg gg        gt c  t       cg g  g       gc        tg at       a  g      a  a at       a  g       gc gc       a  a       gc cg       a  |      c  a g  |      c  |      g  t cg       g  |       tg gc        at        gc at        cg        cg at        ta        gc                         atttttaaaaggaagccttcgctaaaattgaaggctggtccaggagactgtccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................