                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:178 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaccagcttggtttcagttgcgtgggggccgttgcccttgcctccatggcgatgttcgccaatttgcggaaacttgcaggcatcatacgtcccggctggc
tcgtgatgctcgtctttttattcgcatcgatatttgccagttccgacccggcaacggcggtgcgcggtgttctcctcaccacggtcggaattgtggcgat
catagcggttctggtcttgccgcaggatggcgacggttattctgcgctgctcgtatcggtggcgtcggtcgttatcgtcatttcctatgccggggttgtg
TTG

    BMEII1127 --- BMEII1126 Gene: BMEII1127     GI: 17989472     BI number: BMEII1127     GOG: COG3307     Description: EXOPOLYSACCHARIDE PRODUCTION PROTEIN EXOQ Gene: BMEII1126     GI: 17989471     BI number: BMEII1126     GOG: COG0673     Description: OXIDOREDUCTAS            aa           a  c            gt            gt            cg            gc            ta           t  |           t  |           a  |           a  |            cg            cg        gg   g        gc       c  c t  t      |  a      c  t a  t      |  t       cg gc       |  c       tg cg       c  a       gc gc       t  t      c  t gc        ta       a  c ta        gc        tg G  a       tg        at T  t       at        cg T  t       gc        ta gt       c  |       at tg        gc        cg gc        gc        gc tg        tg        gt                         cgtctttttattcgcatcgatatttgccagttccgacccggcaacggcggtgcgcggtgttctcctcaccacggtcggaattgtggcgatcatagcggttctggtcttgccgcaggatggcgacggttattctgcgctgctcgtatcggtggcgtcggtcgttatcgtcatttcctatgccggggttgtgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3307 Lipid A core - O-antigen ligase and related enzymes ... can be seen here [R] COG0673 Predicted dehydrogenases and related proteins ... can be seen here     ..................................................................................................................