                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGGCCCGATCGAGATAAACAGCCCCGTCGCCACCAAGAATGCGGCGCTTGCGGGCC
TCGGCTTCTGCATGTTGCCTGCTTTCATCGCCGAAGATGAGATCGAGCAAGGCAAGCT
GATCACCTGCCTGGACGAATTCATCGTCCGGGATGGCGGCATCTATGCGGTCTATCCC
CATCGGCGCTATCTGCCCGCGAAAATCCGCGCACTCGTGGATTTTATGACCCAATGGT
TCAAGGAGCGGGAATAGtgtctcacttttgccgccttcaggcataagcgtaatccaatgaaattttctATG

    BMEII1136 --- BMEII1137 Gene: BMEII1136     GI: 17989481     BI number: BMEII1136     GOG: COG3683     Description: hypothetical protein Gene: BMEII1137     GI: 17989482     BI number: BMEII1137     GOG: COG2215     Description: putative membrane protei             T           A  C           T  T            CG            GC           C  |            GC            GC            CG           T  C CT       A  | T  A      C  | AT       C  | CG       C  | GC        CG G  G       TA CG       A  A GT       T  A       AC GC       C  A      C  T |  T      T  T       GC TA        GC        CG AT        GC        GT GC        CG        CG GC        GC        CG GC        TG        TA                         TTTTATGACCCAATGGTTCAAGGAGCGGGAATAGtgtctcacttttgccgccttcaggcataagcgtaatccaatgaaattttctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3683 ABC-type uncharacterized transport system, periplasmic component ... can be seen here [R] COG2215 ABC-type uncharacterized transport system, permease component ... can be seen here     ..................................................................................................................