Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.10 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGGCTTCGCCATCACCCGGACCGGCAATGCCTATGCCGTGACGGATAATGACGGTG
TGGATGGAAGCAGCGGCGAAACGCAGTTCTTTTCAATCGGCAAGATCGATTAAgcctgcca
cctttctctcgtaaccgcttgaaacgccgcattcgcttggatgcggcgtttctttcgacgcctgcgataaaagcacgggagaaattttgcacaatcgccg
gtaacggcttgacgaaacgggcctctatcaatattggaacagccaagagagcaaccgactgatttgcttctctctcaggaaGGC

    _v15


Gene: _v15     GI: _v15     BI number: _v15     GOG: -------     Description: tRNA-Cy



 aa
t  c
 gc
 cg
t  c
c  t
t  t
 cg
 ta
 ta
 ta
c  c
c  g       ct
a  c      g  t
c  c       cg
 cg        tg
 gc        ta
 ta        at
|  t       cg
|  t       gc
c  c       cg
 cg        cg
 gc        gc
 At        cg
 At        at
            ttctttcgacgcctgcgataaaagcacgggagaaattttgcacaatcgccggtaacggcttgacgaaacgggcctctatcaatattggaacagccaagagagcaaccgactgatttgcttctctctcaggaaGGC


    ..................................................................................................................