                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.97 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-12.76 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGGCGCTCGGCCTCGACAGCAGCCTCCAGCACCGCAAGGAACTGGCGCAGGAGCTTG
GCTATACCGGCGACATCAATGATTCTGCGACAATGAATGTCTGGCTGCACAAACAGGT
GATCCAGAAACTGAAGGATAGCGGCGGAAAACTGCCTGCTGGCTTATAAaatccccttaaatac
aatcttttggagccgcccctgtgggcggctcattattttttgcatttggcatcttgaccgcttccaaaaccttctttaaacgaccgctcacgccgcagac
gaacgcggcaggtgaaatgcGCG

    _v18 Gene: _v18     GI: _v18     BI number: _v18     GOG: -------     Description: tRNA-As AA A  A GC GT CG GC GC |  T CG GC AT        aa TG       a  t A  G      t  a G  |      t  c GC       c  a AT       c  a AT       c  t G  A      c  c T  T      t  t C  A       at A  A       at A  a       At A  |      A  g       tg G  |      T  |      c  t A  |      A  |       cg C  |       Tg        cg C  |       Ta        cg Ta        Cg        gc At        Gc        cg Gc        Gc        cg T  |      T  |       gc Gc        Cg        at Gc        Gc        gc                         attattttttgcatttggcatcttgaccgcttccaaaaccttctttaaacgaccgctcacgccgcagacgaacgcggcaggtgaaatgcGCG     ..................................................................................................................