Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCATGATTGATTAAtctgcatgtattggggtgggcggatagcggagctggtaaATGCAGCGCTACAGATTTGA
CGACAAGAGAATTCTGACAGAAGCGATTGTAGAACTTCTCAATCAGGGGATCGAACTT
GAAGACCTTGATCTTGTTTTAAGCCGGATCGGCCCGGTTGATCTTGATCTGATGCAGG
AATGCCTGATTGAAGTGTGGAACTACAATCATCCCGAATTGGCGGCCACACAGATGGC
TGCCTGAcgggataaaaggcagacgattacaaaggatcaggccaaggttttcTTG

    BR0011


Gene: BR0011     GI: 23500927     BI number: BR0011     GOG: -------     Description: hypothetical protei


 CG         G
A  A      T  T
 GC       T  A
 TA       A  G
 TA       G  A
 TG       C  A
|  A       GC
|  G       AT
|  A       AT
|  A       GC        AC
|  T       AT       A  T
 AT       |  C       GT
 GC       |  A       CG
 AT       C  A       TA
 CG        AT       |  A
|  A       GC       A  G
|  C       TA       G  A
|  A       CG        GC
|  G       TG        GC
A  A       TG        GT
 TA       |  G       AT
 CG       A  A       CG
 GC        AT        TA
 CG        GC        AT
                        CTTGTTTTAAGCCGGATCGGCCCGGTTGATCTTGATCTGATGCAGGAATGCCTGATTGAAGTGTGGAACTACAATCATCCCGAATTGGCGGCCACACAGATGGCTGCCTGAcgggataaaaggcagacgattacaaaggatcaggccaaggttttcTTG


    ..................................................................................................................