                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:207 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-23.40 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGTGGGATGACGGCAAGATCGTCGGTCTTGAATAAgttttactgacttgacgtgatatgaaatgccggggcg
ggaaaacgccccggcattttgtatttcccggctccataaaaataaagcatgtcaaattttataaaattcatacaacacaccgagacgggtcctgtaacag
aattgctagaactgttctaattatttgttttgttgcattttccaacgcaaaaccgctttgcacttttgctagaaatgttatagagcgattctggttaaaa
tagaatcgttggaaaagctctatatctTTG

    BR0013 --- BR0012 Gene: BR0013     GI: 23500929     BI number: BR0013     GOG: -------     Description: hypothetical protein Gene: BR0012     GI: 23500928     BI number: BR0012     GOG: -------     Description: hypothetical protei at t  g a  a g  a       aa ta       g  a gt       g  a cg        gc a  c       cg gc        gc tg        gc tg        gc cg        gc a  g       cg gc        cg tg        gc cg        ta             ttttgtatttcccggctccataaaaataaagcatgtcaaattttataaaattcatacaacacaccgagacgggtcctgtaacagaattgctagaactgttctaattatttgttttgttgcattttccaacgcaaaaccgctttgcacttttgctagaaatgttatagagcgattctggttaaaatagaatcgttggaaaagctctatatctTTG     ..................................................................................................................