                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=2 nt.   Size=38 nt.     Delta G=-18.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCCGCGATAACATCTATCTCGGCGTGGAAGCCGGTGCGCGCGGCACGACCAAGGGAA
CGGTCAATCTCGACATTTCCCGTAACCTGAAAGTCAAGGGCGCGTTTGGCGCTGAGGA
CGACTCCAGCGGCGGCATCTTCTATGAAAAGGACTATTGAtcgggcctgctttggcccgattccttaatt
ttgtgcacgcgctccgggatggcttaacgtttcttcaaccataagatcgcaaattgttagcaattatgagcggccattacggccattttgccagcaattt
cttaggcgatttatATG

    BR0050 Gene: BR0050     GI: 23500965     BI number: BR0050     GOG: COG1376     Description: lipoprotein, putativ   C A  G G  A GC AT |  C GC TA CG                  ct GC        AG       g  t CG       A  G      t  t G  G      A  A       cg GC       A  C       cg TG        GT        gc T  |       TA        gc T  |       AT        gc G  |      T  T       cg CG        CG        ta GC        TA        At C  A      T  t      G  | G  T      C  c      T  | GC       T  g      T  | GT       A  g      A  | AT        Cg       T  | |  C       Gc       C  | |  T       Gc        At |  A      |  t       Gc AT        Cg        Gc CG        Gc        At TA        Gt        At                         aattttgtgcacgcgctccgggatggcttaacgtttcttcaaccataagatcgcaaattgttagcaattatgagcggccattacggccattttgccagcaatttcttaggcgatttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1376 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................