Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:81 nt.     Distance to run of Ts=2 nt.   Size=16 nt.     Delta G= -6.60 kcal/mol
Antiterminator:    Distance from promoter:60 nt. Size=42 nt.     Delta G= -7.01 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATG-TATGAT. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATGATCTTGGAATTTTTGCTTATGATTTCAATGCATTGATTGAATGGGTCGCGCG
TATTTGAttgctcggcagagcaagttgttacgctttgaaacattcattttgacgcaccgccggcgtttagagcttccgctctatgtcttttgcgt
ggtacacgattgtcatcgaccgaaagaagactgactgaggcgggctgccaaggcccgtgtaagccaagaggatctggATG

    BR0066 --- BR0067


Gene: BR0066     GI: 23500981     BI number: BR0066     GOG: -------     Description: conserved hypothetical protein
Gene: BR0067     GI: 23500982     BI number: BR0067     GOG: COG0741     Description: Transglycosylase SLT domain protei



  g
c  c
c  c
a  g
 cg
 gc
 cg
 at
g  |
t  |
t  |
t  |
t  |
a  |
c  |
t  |
t  |
a  |
c  |
a  |
a  |       tc
 at       t  c
 gt        cg
 ta        gc
 tg        at
 ta        gc
 cg        at
 gc        ta
            tgtcttttgcgtggtacacgattgtcatcgaccgaaagaagactgactgaggcgggctgccaaggcccgtgtaagccaagaggatctggATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG0741 Soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains) ... can be seen here

    ..................................................................................................................