Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:205 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATTTCCGCGGCACTGGCCGCGATCCAGAAGTGCAAATAATCCAGAAGATCAGGCAG
AACTTCAAAGCCGGGCTTCGTGCCCGGCTTTTTTCTTTTGCGCCCATCCCCGCAATCT
TGCACGACACGCCAGATTTCATGCGGGATGACGAGCGGGTTATTCTGTGCTAAGAGCC
GCGCCATCGGGTTCGCATCTCGCATGGAAAGATGATCGAACCCATATATTCATGTAAT
CGACCCAGATAATCTGGAAGTTTTATCGGCGCGCGTGATCGCGGTCGCCCTGCAATAG
TTGAAAACAGATG

    BR0077 --- BR0076


Gene: BR0077     GI: 23500991     BI number: BR0077     GOG: COG0820     Description: conserved hypothetical protein TIGR00048
Gene: BR0076     GI: 23500990     BI number: BR0076     GOG: NOG18508     Description: hypothetical protei


  T
C  T
A  C
A  A
G  A        C
A  A      T  G
 CG       T  T
 GC        CG
 GC        GC
A  G       GC
 CG        GC
 TG        CG
A  |       CG
 GC        GC
 AT        AT
 AT        AT
 GC        AT
            TTTCTTTTGCGCCCATCCCCGCAATCTTGCACGACACGCCAGATTTCATGCGGGATGACGAGCGGGTTATTCTGTGCTAAGAGCCGCGCCATCGGGTTCGCATCTCGCATGGAAAGATGATCGAACCCATATATTCATGTAATCGACCCAGATAATCTGGAAGTTTTATCGGCGCGCGTGATCGCGGTCGCCCTGCAATAGTTGAAAACAGATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0820 Predicted Fe-S-cluster redox enzyme ... can be seen here

    ..................................................................................................................