                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-19.60 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCAACTTTCTGCCAGCCGTCCAGCGCCCTGAGCGCCTCGTTCATTTCGCTTTCCGTCA
ATCGGTTGCGTGCCATcgtctttcgcctatgttgcgggtttatatcaaccgaccaaagccgtgagagttccgtgattataccaggctg
tagtgacggattaacttgtggtttggtatgggcaaaaaatcttcagctttaggagcgaaaccgaaggtggagtgtatctccatcaaggtttcgcgacgcc
aagatggagtttttttgccatatcccgaagggacgcggtgtattttgcttctgaATG

    BR0083 Gene: BR0083     GI: 23500997     BI number: BR0083     GOG: COG0394     Description: phosphotyrosine protein phosphatas             t           g  a           t  t   g        gc c  a       at        gc g  a       gc       c  g a  a       gc       t  a gc        ta       t  c gc        gt        tg a  |       gc        gc tg       a  a       gc ta       a  a      a  a ta       g  |      a  a cg        cg        cg g  g       cg        ta at        at        at cg        at        cg tg        at        cg ta        gc        ta cg        cg        cg                         tttttttgccatatcccgaagggacgcggtgtattttgcttctgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0394 Protein-tyrosine-phosphatase ... can be seen here     ..................................................................................................................