                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-25.30 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-11.80 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-16.72 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCCCCGTCGGAAACCGGATGGTAGCGGTAGTCTCATTCCCCTCTCCGGGCTGCCGCT
GTGTAGTGACATGGCCGCTGTGGTAATCCCCTCACCACAGCGGCCAATCTTTTCCCCC
TCGCCTTTTGCATGAAAAACATTGGTCGCCACtcgcctggcgcataaacgtcatcttcacagcgcccatatttttt
tgccgaattcgcctctgaaatccgcgtcaagtcgagcttaatgagggttttaacttcgcaaagctggttgtagtgtgccatcagttttatgactcgtcag
gaagccccATG

    BR0121 --- BR0120 Gene: BR0121     GI: 23501035     BI number: BR0121     GOG: COG0624     Description: peptidase, M20/M25/M40 family Gene: BR0120     GI: 23501034     BI number: BR0120     GOG: COG0349     Description: 3'-5' exonuclease family protei   C        AG C  C      T  T        C C  T      G  G      C  C T  C       TA       T  C T  T       GC       A  T A  C       TA       A  C C  C      C  |       TA TG        GT        GC CG        CG        GC TG        CG        TA GC        GC        GC AT       T  C       TA TG        CG        CG GC        GC        GC GC        GT        CG CG       |  G       CG GC        GT        GC AT        CG        GC TG        CG        TA                         ATCTTTTCCCCCTCGCCTTTTGCATGAAAAACATTGGTCGCCACtcgcctggcgcataaacgtcatcttcacagcgcccatatttttttgccgaattcgcctctgaaatccgcgtcaagtcgagcttaatgagggttttaacttcgcaaagctggttgtagtgtgccatcagttttatgactcgtcaggaagccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0624 Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases ... can be seen here [J] COG0349 Ribonuclease D ... can be seen here     ..................................................................................................................