                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:203 nt.     Distance to run of Ts=2 nt.   Size=33 nt.     Delta G= -9.24 kcal/mol
Antiterminator: Size=25 nt.     Delta G=-11.80 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCACTCGGCCGCCTTGCGGCAATCGGCCTTGTAGGCCGGGTCGGTCGAAATCGACTT
GATCCGCAAAAGATTGAACAGGCGGTCGAGGCTTTTGTTGAGATTGGCGTCGAGATGG
TTGAGAACTTTGTCGAGTGATAGCGTGGACATggggcttcctgacgagtcataaaactgatggcacactacaacca
gctttgcgaagttaaaaccctcattaagctcgacttgacgcggatttcagaggcgaattcggcaaaaaaatatgggcgctgtgaagatgacgtttatgcg
ccaggcgaGTG

    BR0122 Gene: BR0122     GI: 23501036     BI number: BR0122     GOG: -------     Description: hypothetical protei   a c  g cg                  TT gc                 A  G cg                 G  A g  a                A  A tG        AA       A  C aT       A  T      A  A tG        GC       A  G tG        CG        CG tG        TA        GC g  |       GC        CG cG       |  T       CG aT        GT       T  | gC        CG        AT |  G       TA        GC tG        GT        TG aT        GC        TA gC        GC        CG                         GCTTTTGTTGAGATTGGCGTCGAGATGGTTGAGAACTTTGTCGAGTGATAGCGTGGACATggggcttcctgacgagtcataaaactgatggcacactacaaccagctttgcgaagttaaaaccctcattaagctcgacttgacgcggatttcagaggcgaattcggcaaaaaaatatgggcgctgtgaagatgacgtttatgcgccaggcgaGTG     ..................................................................................................................