                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-11.80 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTGAAGTGCCCAATCCAGATCTGCCCAACAATACGGTGGTGCAGGTGGTGCAGGCCG
GTTACGCCATCGGCGACCGCGTGCTGCGCCCGGCCATGGTGGGCGTTTCCAAGGGAGG
CCCGAAGGTTTCCGCCGAAAACGGCGCCTCGACCTCAGAAGACAATGCGTGAtccgattgc
gcaggcgtattgaaaaagcagcggcatcatttgccgctctttttatttccgctttttctattacgcttgaggcagcgcgggtggaaacttgaaccggacg
atcaagcgaaggctcgtagagacGTG

    BR0170 Gene: BR0170     GI: 23501081     BI number: BR0170     GOG: COG2860     Description: conserved hypothetical protei   c c  g        g ta       c  t At       g  a G  t       gt T  g       at Gc        cg Cg       |  a Gc       |  a T  |      |  a A  |      |  a A  |      g  a        a C  |       cg       c  t A  |       gc       t  t G  |       ta        at A  |       tg        cg A  |      a  |       gc G  |       gc        gc A  |       cg        cg C  |       cg        gc Ta       |  c       at Cg        ta       c  | Cg        At        gc A  |       Gc        at Gc        Ta        at Cg        Gt        at                         ttatttccgctttttctattacgcttgaggcagcgcgggtggaaacttgaaccggacgatcaagcgaaggctcgtagagacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2860 Predicted membrane protein ... can be seen here     ..................................................................................................................