                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCACCTTGCGTGAGCGCGAAATCCTGCGTTGGACGAGCGAAGGCAAGACTGCCGAGA
TCATCGGGACAATCCTCAATATCTCGACGCGAACGGTCAATTTCCACATCAGCAACGT
GCTCACCAAGCTTGTTGCGGTCAATAAGGTGCAGGCCGTCGCCAAGGCCCGTACATTT
GGTCTCCTCTGAccttttccagtgtccctcggcggtttgtaccgacgggcattttctgcggctttccggtttgcgctttccctgaaaaagg
ctacacattcattatcgttcttggaggatgaatgaATG

    BR0191 Gene: BR0191     GI: 23501102     BI number: BR0191     GOG: COG0161     Description: aminotransferase, class II            CT           C  C           T  T            CG            TA            Gc            Gc           |  t           |  t           |  t           |  t           |  c           T  c            Ta         t            Tg       t  t GC        At       g  g C  C       Cg       g  t T  A       At       c  a G  A      |  c       gc CG       |  c       gc CG       |  c       cg GC       |  t       ta GC       |  c      c  c A  C      |  g       cg CG        Tg        cg GT        Gc        tg TA        Cg        gc GC        Cg        ta                         ttttctgcggctttccggtttgcgctttccctgaaaaaggctacacattcattatcgttcttggaggatgaatgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0161 Adenosylmethionine-8-amino-7-oxononanoate aminotransferase ... can be seen here     ..................................................................................................................