                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGACGGAGGAATCCTTGCCGACCGAATAGAGCATCACCGGATTGGAGAATGTCGCCG
CCACCTCACGGAAAACATGGATGGCTTCTGCTTCAAGGCGCTGCAAATGCGTCAGGTT
TTTCATcagggatacatgatgcacggcatttactcccgcaaaccggctggagcggttccgattaaaacggaacccctctatttctttgttttcaag
cattatccgacgcaaaactggcggcagacaaaggcaaatgccttcgtccggcgcaaagtgacgggtcacgatgcgtgcattgtcgtgaATG

    BR0192 Gene: BR0192     GI: 23501103     BI number: BR0192     GOG: -------     Description: hypothetical protei Tc A  a Cg Tg Tg        ac Ta       a  c T  t      a  g        a Ta        cg       t  a Gc        gc       t  a G  a      c  t      a  a At        cg        gc Cg        cg        cg Ta        ta        cg Gt        cg        ta Cg       a  c       ta Gc       t  |       gc Ta        tg        gc A  c       tg       c  c A  g       at        gc A  |      c  t       at Cg        gc        gc Gc        gc        gt Ta        cg        ta                         tttctttgttttcaagcattatccgacgcaaaactggcggcagacaaaggcaaatgccttcgtccggcgcaaagtgacgggtcacgatgcgtgcattgtcgtgaATG     ..................................................................................................................