                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCACACCATTGTGGCACGCGCGAAGCCTTTGATGATATTTTATGGGCTCCCGCCAAAA
GCCGACAGCAGGCTTGCGTCACAAGACGCCATAAATACGACATGCGCACCATtacgcgaca
tttggctgtggctttcaggccgccgcaaaggcgggctgtgcttgttggggggtgtgcgaatttgccatcacagataggacaacactattgtcctttttgc
tttccttttgttgcgcaaaggcgtagtcagaaatacgcaaaatcgcatttttaaaaacatacacgcaagaaaggtgatttcGTG

    BR0227 Gene: BR0227     GI: 23501134     BI number: BR0227     GOG: COG0334     Description: glutamate dehydrogenase, putativ            tt           c  t           c  t           t  g           t  t           t  t       ag            cg       c  a            gc       t  a   c        tg       g  a a  t      t  c       at c  a       ta        ta at        ta        gc at        ta        cg cg        cg        gc at        cg       g  a gc       t  |      a  a gc        gc       a  a at        tg       a  a t  t      t  |      c  t at        at        gc gt        ta        cg at        cg        gc cg        at        ta                         tttttaaaaacatacacgcaagaaaggtgatttcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0334 Glutamate dehydrogenase/leucine dehydrogenase ... can be seen here     ..................................................................................................................