                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTAACGCTGACGCCGCTTGCCCATCATACGGTGCTGGAGCGTATGCGGGGCTTTTCGG
TCGATGTGGAATATTGGCCGACGCCGGACCCAACGCTCGTGACCGGCAGCCGTGAGCA
GATCATGGCCGCCTATCGCGATGTTCGCGACCGGCTGAAACGGCGAATCACATTGCGT
TTCGGCTTCGGTTGAgccattccaattcgttgttcacaaatgccgcctaatcatataggttccgcccaaattaagggccgaagctttta
ttcggcggcttttatcaaagaaagaaacaggtatcgcATG

    BR0247 --- 1 --- Phe Gene: infA     GI: 23501156     BI number: BR0249     GOG: COG0361     Description: translation initiation factor IF-1 Gene: maf-1     GI: 23501155     BI number: BR0248     GOG: COG0424     Description: maf protein Gene: BR0247     GI: 23501154     BI number: BR0247     GOG: COG3024     Description: conserved hypothetical protei                      ga                     c  a                      cg                      gc                      gt                      gt ca                  at t  t                 at a  a        t        ta at       a  t      t  t ta       a  a      a  t cg       a  a      a  c cg        cg       a  | gt        cg       c  | |  t       cg        cg |  c       gc        cg c  c      c  c       gc cg        cg        cg gc        ta        cg                         cttttatcaaagaaagaaacaggtatcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0361 Translation initiation factor 1 (IF-1) ... can be seen here [D] COG0424 Nucleotide-binding protein implicated in inhibition of septum formation ... can be seen here [S] COG3024 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................