                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:129 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-12.50 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCTCGCTGGTCGTAGGCGTGGTGATGAGTGCTTTCCACTGGACGCCCTACGATATTC
TCTATGGCATCCGCGATTTCTTCCTGCACCTGTGGAACATGGGTTTTTCGGCCGTTGC
GCGTTTTGCCGATTATCTCGTTCTGGGGGCAGCGGTGGTCATCCCTGCCTTTATTTTG
CTCCGTATCCTCAGCTATCGTAAATGAacggaatttcagcgatacatcagatacagtcagccaatgcagcaaaaacatgg
aattcgcttgtcccggcggggctttctcatgctcgccgggggtgcaATG

    BR0309 Gene: BR0309     GI: 23501216     BI number: BR0309     GOG: COG2340     Description: conserved hypothetical protei             A           T  T           T  C            AT            GC            CG           |  T           C  T           G  C           T  T            TG   G        TG         T T  C       TG       G  C T  G      G  G      G  A GC        CG       T  T CG        GC        GC |  T      |  A       GC |  T       CG       C  | |  T       GC        GC |  T      T  G       AT CG       T  G       CG GC        GT        GC GC        CG        GC CG        CG        GT TA        GT        GT                         TATTTTGCTCCGTATCCTCAGCTATCGTAAATGAacggaatttcagcgatacatcagatacagtcagccaatgcagcaaaaacatggaattcgcttgtcccggcggggctttctcatgctcgccgggggtgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2340 Uncharacterized protein with SCP/PR1 domains ... can be seen here     ..................................................................................................................