Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-16.25 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTTCGCGGGCTGCGGCCAGAGTGGTTTTCGGGTCTCCGGCAAGCTGGATGAACATA
TTGGAGAAATCAATGCCGCCAGTGATAAGGCCGATAATCGGCATGATGATATCATTGA
CGATGGAGTTGACGAGGCCACCGAACGCCCCGCCGATGATGACACCGATGGCCAGATC
GACCATATTGCCCTTCAGGGCGAATTCCTGGAATTCTTTTAACATaaagcctgtctccctcacgaat
gcggatcgcaggctgggccgtcatggctgcgatgcattcgtcaaaacaactggcgccaaATG

    BR0317


Gene: BR0317     GI: 23501224     BI number: BR0317     GOG: -------     Description: hypothetical protei


           CG
          C  A
          G  T
          C  G
          C  A
          C  T
 TG       C  G
T  A      G  A
A  C      C  C
 CG       A  A
 TA       A  C
 AT        GC
 TG        CG
A  G      C  A
G  A       AT
 TG        CG
 AT        CG
 GT        GC
 TG        GC        TC
A  A      A  A      T  A
C  |      G  G       CG
G  |      C  A       CG
 GC        AT        CG
 CG        GC        GC
 TA        TG        TG
A  |       TA        TA
A  |       GC       |  A
T  |      A  C      |  T
A  |      G  A      |  T
G  |       GT       A  C
 CG        TA       T  C
 CG        AT        AT
 GC        GT        CG
 GC        CG        CG
                        AATTCTTTTAACATaaagcctgtctccctcacgaatgcggatcgcaggctgggccgtcatggctgcgatgcattcgtcaaaacaactggcgccaaATG


    ..................................................................................................................