                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=2 nt.   Size=16 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCTTCACTTTAGggcggttccgcttaaaacgaaatcgctggaaccgctctatctatttgttttatcgcattatttaacgcatcgaagcgg
gatcggaaatcagtccagtggactgatttccccgcgtaggcgtttcacacttttggctcgaaaatgctttaggtgctcctgaaaatcagttacccacaaa
tgggtatgtatttttccctttgcactatcgtcggcttgcggcagaaattctgtggcaatattatcccgcgcgaaaccgcttgaggaggcgggaacaaagg
ggaggtgggATG

    BR0343 --- BR0344 Gene: BR0343     GI: 23501248     BI number: BR0343     GOG: COG4665     Description: conserved hypothetical protein Gene: BR0344     GI: 23501249     BI number: BR0344     GOG: COG4664     Description: TRAP dicarboxylate transporter, DctM subunit, putativ aa g  a c  a t  t cg gc gt t  t t  t ta tg         a cg       a  a at       a  t cg        gc |  c       ta |  t       cg        aa |  c      c  t      c  a |  c      t  |       at at       c  |       cg cg        gt        cg ta        ta        cg ta        gc        at ta        gc        ta                         tgtatttttccctttgcactatcgtcggcttgcggcagaaattctgtggcaatattatcccgcgcgaaaccgcttgaggaggcgggaacaaaggggaggtgggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG4665 TRAP-type mannitol/chloroaromatic compound transport system, small permease component ... can be seen here [Q] COG4664 TRAP-type mannitol/chloroaromatic compound transport system, large permease component ... can be seen here     ..................................................................................................................