                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:76 nt.    Distance to gene:69 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G= -7.90 kcal/mol
Antiterminator:    Distance from promoter:60 nt. Size=27 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:    Distance from promoter:13 nt.    Size=59 nt.     Delta G= -3.79 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-tagctt. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgattttctgtggtttattttagcttcgcaccggacttggcgctaaacaccgcaaaccacgcaatgttcccagcattcagtattccgccatcctccgca
ttatgaaagatggttatccttggatgtctttcaaatttttagggggggaatagccatgataaatctttattatcatgggcaaaacaagtgagaatgaggg
aagacccgcATG

    BR0347 --- BR0346 Gene: BR0347     GI: 23501252     BI number: BR0347     GOG: COG0726,COG3195     Description: conserved hypothetical protein Gene: BR0346     GI: 23501251     BI number: BR0346     GOG: COG3257     Description: conserved hypothetical protei   c c  c t  a tg gc ta at at c  c g  a cg at c  a c  t a  t                 tt a  c                c  g a  c                 cg cg        at        ta gc       c  t       at c  c      g  a      t  | c  a      c  t      t  | a  t       cg       g  | c  c       ta       g  | a  c      |  a       tg a  t      c  a       at a  c       cg        gc t  |       ta        at c  |       at        at gc        cg        at cg        cg        gc gc        gt        ta                         aatttttagggggggaatagccatgataaatctttattatcatgggcaaaacaagtgagaatgagggaagacccgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0726 Predicted xylanase/chitin deacetylase ... can be seen here [S] COG3195 Uncharacterized protein conserved in bacteria ... can be seen here [R] COG3257 Uncharacterized protein, possibly involved in glyoxylate utilization ... can be seen here     ..................................................................................................................