                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-11.12 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCCGTGCGCTCTCCATGGAAGACAGGATCGGCACGCTGGAAGAGGGCACGGAAGCCGA
TATCGTGGTGCTCGATTCCTCCGCCACATCGCCCATGCGCCTGCGCATGGCGGCAGGA
GCGACGCTGGAGCAGGAACTGTTCCTGTTGCAGACGCTGGGTGACGACCGCGCCATTG
TTGAAACCTATGTGGCGGGTAAACCCATGAAAGCCGATCTTTTGTAAgagaagaaagcgggcttc
gttgattttattcgggcagcgcggaatagtcctgccagctacacatcatatcgggaatctcATG

    BR0355 Gene: BR0355     GI: 23501260     BI number: BR0355     GOG: COG2379     Description: hydroxypyruvate reductase, putativ             A           A  A           G  C       AA           T  C      T  A           T  T       GC           G  A       GC           T  T       GC   G        TG       |  A C  A       AT       |  T A  C       CG       |  G GC        CG       |  A TG        GC       |  A GC        CG       |  A |  G      G  |       CG GC        CG        GC GC        CG        GC TA        AT        TG                         ATCTTTTGTAAgagaagaaagcgggcttcgttgattttattcgggcagcgcggaatagtcctgccagctacacatcatatcgggaatctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2379 Putative glycerate kinase ... can be seen here     ..................................................................................................................