                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACAAGATCGCCGTTGCCGTTCCCTGCCACCGCGTGGTGCGCAACGATGGCGGCATTTC
CGGCTATCGCTGGGGCGTGGAACGCAAGCGCGACCTGCTTGAAAGGGAGCGCAAGGCA
TGAtcgggcataagccttgacggtgtttttgaaacaatgtcgcaaggcgcccggtatcatctttcccgattcccgatcgtgcaatttgccagcctgta
taaagacggtgaaaacgggcggatgcggttgcatctgtcggcccgatgaattctgatcgccggccagacacggaaggagttgggatATG

    BR0369 Gene: BR0369     GI: 23501274     BI number: BR0369     GOG: COG1393     Description: conserved hypothetical protei             T           T  G       cg           C  A      t  g AG       G  A      A  g A  C       TA        Gc CG        CG        Ta GC        CG        At CG       A  G      |  a A  A      G  A      |  a A  |       CG        Cg GC        GC        Gc GC        CG        Gc T  |       GC        At GT       |  A       At CG       A  A       Cg GC       A  G      |  a GT        CG        Gc GT        GC        Cg                         gtgtttttgaaacaatgtcgcaaggcgcccggtatcatctttcccgattcccgatcgtgcaatttgccagcctgtataaagacggtgaaaacgggcggatgcggttgcatctgtcggcccgatgaattctgatcgccggccagacacggaaggagttgggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1393 Arsenate reductase and related proteins, glutaredoxin family ... can be seen here     ..................................................................................................................