                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:53 nt.    Distance to gene:69 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-21.10 kcal/mol
Antiterminator:    Distance from promoter:23 nt. Size=38 nt.     Delta G= -6.54 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtcacg-catatt. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtcacgacagcttggcgcttgagcatattattagcacttgcacatattaattgctgccataaatagtttctcactgctcgctgaagcggctccgtctcaa
aagacggttgggctgcttcatttattttgattatatttttccgatgcatggctatggggcagccttgccggaaatactctggaaacggggaagcccATG

    BR0370 Gene: BR0370     GI: 23501275     BI number: BR0370     GOG: COG4129     Description: conserved domain protei ct a  t cg gc |  a |  c |  a at ta                  aa t  t       tc       c  a at       c  a       ta ta       t  c       cg ta       t  t       ta at        tg        gc t  |       gc        cg at        at        cg cg       t  c      |  t gc       a  g      |  t at       a  c      |  g g  |      a  t       tg t  |      t  g       cg t  |      a  a       gc c  |      c  a       gt g  |       cg        cg cg        gc        gc gc        tg        at gc        cg        at ta        gc        gc                         atttattttgattatatttttccgatgcatggctatggggcagccttgccggaaatactctggaaacggggaagcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4129 Predicted membrane protein ... can be seen here     ..................................................................................................................