                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-15.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.65 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-20.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCGACGCCATGCCGCAATCCTATGTGCGCTATCTCATCAACGGCCTGCGCGAAACC
TTCGACATGCCGGGCGTGCCGATAAGGCTTTCCCTGCGAACCTCGGACAATCCGTTCG
CAGGCCGCGCGAAAAAGAAGAAGTGAtgcaaagcccggagtgatccgggctttttcacaggcagccgagatcaagccatag
cggatgcgcggcagagcccgaaatcttcatatgaatgcttgtgtctcgctcacctctctgttaacccgccgcctcccgaattttctcccggaaaggcaga
accATG

    BR0376 Gene: BR0376     GI: 23501280     BI number: BR0376     GOG: COG0443     Description: heat shock protein, Hsp70 famil   A C  A A  T GC GC C  | T  | C  | CG AT AT GC        AA CG       G  G GC       A  T TA       A  G CG       G  A C  |      A  t C  |      A  g T  |      A  c T  |      A  a T  |      A  a CG       G  a GC        Cg GC        Gc A  |      C  c A  |       Gc T  |       Cg        tg A  |       Cg       g  a G  |      G  a       at C  |      G  |       gc CG       A  |       gc GC        Cg        cg TG        Gt        cg GC        Cg        cg CG        Ta        gc                         tttttcacaggcagccgagatcaagccatagcggatgcgcggcagagcccgaaatcttcatatgaatgcttgtgtctcgctcacctctctgttaacccgccgcctcccgaattttctcccggaaaggcagaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0443 Molecular chaperone ... can be seen here     ..................................................................................................................