                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGCAACCGGCACCTTCGGCGACAAGCGCCGTGCCGTCACCCGAGCCATGGTCGATC
ACCGTCACGCGCCGCAGCAGCCCTTCCACCACAGCCGGCACCAGCCCTGACAGCGTGC
AGGCGAGTGGACGTTCTGAATTGAGCGTTTCGATAATCACGGACAACATgcccgttcatagctg
aggtttacccggccggaaagggtgcccctatttttgttcttgatttgttctgacaattgcgataggaatagattcatcagcaagctggtcgggaaacagg
ccggccgcagggagacaaagATG

    BR0387 Gene: BR0387     GI: 23501291     BI number: BR0387     GOG: COG1533     Description: conserved hypothetical protei   C A  A AT Cg A  c Gc Gc                   g Cg                 c  g At                 c  a C  t                g  a T  c                g  a A  a                 cg At        tt        cg Ta       t  a       cg |  g       gc        at A  c       gc        tg Gt       a  |      t  c Cg        gc       t  c Ta        tg        gc Tg        cg        gc Tg        gc        at                         atttttgttcttgatttgttctgacaattgcgataggaatagattcatcagcaagctggtcgggaaacaggccggccgcagggagacaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1533 DNA repair photolyase ... can be seen here     ..................................................................................................................