                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.80 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcaattgatccgggccgggcgcggtggcggacctttcgccgctgcaatttgaaggcttcgtggctgaccggggcgcccatgagggatgcttttcttgttc
cgccatcccaaaaaggccatgcttggggtgccttttcggacagagggggcggttgttttatgggagccgccacaaatatgtccagcaaaagtgtgacctg
attttgcgccggatgatgcgacaaaacaaagagttggagcggttctgccgattgtgttgaaacaggaagcgctccagggaactgaaaaggatagggcttt
ATG

    BR0402 Gene: BR0402     GI: 23501306     BI number: BR0402     GOG: COG0457     Description: TPR domain protei gc t  t at gt gt gc         a at       c  t gt        cg tg        gc at        gt c  t      a  | c  c      a  | c  |      a  | gc       a  | cg        at gc        cg |  c       cg |  a       cg |  t       tg gc        at         a gc        cg       g  c gc       |  c      g  a |  a      |  c       cg c  a      |  t       ta c  a      |  t       tg a  a      |  t       tg g  a      c  t       tg tg        gc        cg cg        cg        cg gc        cg        gc gc        ta        tg                         gttgttttatgggagccgccacaaatatgtccagcaaaagtgtgacctgattttgcgccggatgatgcgacaaaacaaagagttggagcggttctgccgattgtgttgaaacaggaagcgctccagggaactgaaaaggatagggctttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0457 FOG: TPR repeat ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:206 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.60 kcal/mol Antiterminator: Size=39 nt.     Delta G= -9.60 kcal/mol Anti-antiterminator:   Size=50 nt.     Delta G=-21.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tcaattgatccgggccgggcgcggtggcggacctttcgccgctgcaatttgaaggcttcgtggctgaccggggcgcccatgagggatgcttttcttgttc cgccatcccaaaaaggccatgcttggggtgccttttcggacagagggggcggttgttttatgggagccgccacaaatatgtccagcaaaagtgtgacctg attttgcgccggatgatgcgacaaaacaaagagttggagcggttctgccgattgtgttgaaacaggaagcgctccagggaactgaaaaggatagggcttt ATG     BR0402 Gene: BR0402     GI: 23501306     BI number: BR0402     GOG: COG0457     Description: TPR domain protei   c c  t at gt gc cg        cg gc       t  t gc        tg tg        cg gc        gc gt        gt cg       a  g gc       a  a |  a      g  c |  a      t  | |  t      t  | |  t      t  | c  t      a  | g  g      a  |       tg g  a      c  |      a  a g  a       gc        cg cg        tg        cg cg        cg        cg gc       g  |      |  a |  t       cg        gt gt        cg        cg gc        gc        gc cg        cg        gt                         tttcttgttccgccatcccaaaaaggccatgcttggggtgccttttcggacagagggggcggttgttttatgggagccgccacaaatatgtccagcaaaagtgtgacctgattttgcgccggatgatgcgacaaaacaaagagttggagcggttctgccgattgtgttgaaacaggaagcgctccagggaactgaaaaggatagggctttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0457 FOG: TPR repeat ... can be seen here     ..................................................................................................................