                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-15.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGCTGGCGCTTGCCAAGCTGCGTGGCCCGGTTGATATCTTCTTCGACAAGGTGCTGG
TCAATGACGAGGACGGGAATGTTCGCGCCAACCGGCTGGCGCTGCTCGACCAGATCCG
CGCGGCCACAGGCAAGGTGGCCGATTTCTCGAAGATCGCCGGATAAgagcctgaggggcgccgcga
ggcgccctttttattggctggatcattctcatcttgcatgaagttggtgccggatgcgcccggatgttgcttgcccggcgcgcgtgctttgtgtagctaa
tcgggcaggagacgagccGTG

    BR0405 --- BR0406 Gene: BR0405     GI: 23501309     BI number: BR0405     GOG: COG0009     Description: Sua5/YciO/YrdC family protein Gene: BR0406     GI: 23501310     BI number: BR0406     GOG: COG0277     Description: oxidoreductase, FAD-bindin   C G  A G  A A  G CG AT         G CG       G  A CG       C  T GC       C  A GC       G  A CG        Cg |  A       Ta |  T      A  g |  T      G  c |  T      A  c |  C      A  | |  T       Gt GC        Cg CG        Ta G  A       Cg C  A       Tg        cg CG        Tg       g  a TA        Tg        cg AT       A  |       cg GC        Gc        gc A  G       Cg        cg C  C      C  |       gc C  |       Gc        gc A  |       Gc        gc GC        Tg        gt CG        Gc        at                         tttattggctggatcattctcatcttgcatgaagttggtgccggatgcgcccggatgttgcttgcccggcgcgcgtgctttgtgtagctaatcgggcaggagacgagccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0009 Putative translation factor (SUA5) ... can be seen here [C] COG0277 FAD/FMN-containing dehydrogenases ... can be seen here     ..................................................................................................................