                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-11.80 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGATCACCACGATTGCCGAATCCAGCACCAACAACAAACTCTGCCGTCAGTTTGAAA
CCTCGCGTGAGGCATTCGACGGCGTTTCGATCTATCGCGGCGAAACCTGTATGGAGCG
CGGCGGCCAGTGGACGGTTACTGCGTTCGCGCCGATCTGAtccagtcagactgaaacgcgctttaaatga
atttcagattcaagccgtgtgaggctggaacttttgcggctgtatacgcatattagctgtgaaaacgagtctatccattggctttacagccttttttcct
gaaagaggaactatATG

    BR0418 Gene: BR0418     GI: 23501321     BI number: BR0418     GOG: COG2214     Description: chaperone protein DnaJ, putativ            cg           a  c            ta            at            ta           |  t            gt            ta            cg         a   t        gc       t  t c  t       gt       c  c at        cg       t  c at       g  t      g  a g  g      t  g       at gc        ta        gt tg        ta        cg cg        ta       a  g gc       c  a      a  c gt       a  c       at a  g      a  g       at gt       g  |       gt ta       g  |       ta gt        ta        gc ta        cg        ta gc        gt        cg cg        gc        gc                         cttttttcctgaaagaggaactatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG2214 DnaJ-class molecular chaperone ... can be seen here     ..................................................................................................................