                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:4 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-26.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-12.40 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGGAAGAATGGCGCCAGATCGGCCTTGGCGCGCAGATTTTGAAGGATCTCGGCGTT
TCCTCCATCGTGCTTCTGGCCTCGCGTGAGCGCCACTATGTCGGCCTTGAAGGTTTCG
GCATTTGCATCACGCGTACGGAAATTATCTAAtgcatgtctcccaaaagcgggaaccggttttgggatgaaaacat
gcataaaaacaaaagtttcgtgtcgtaagagtacgataaaacgcggcgcgctttaaatggcatcaattaacaggcggcctcgcggcggggccgcctgttt
tttcttccATG

    BR0430 --- xseB Gene: BR0430     GI: 23501331     BI number: BR0430     GOG: COG0123     Description: histone deacetylase family protein Gene: xseB     GI: 23501332     BI number: BR0431     GOG: COG1722     Description: exodeoxyribonuclease VII, small subuni            ca   a       g  t a  c       gc a  g       ta a  c      a  a t  g       at a  g       at gc        ta cg        ta         g a  c      |  c      c  g t  g      |  a       gc gc        tg        cg at        cg        tg gt        gc        cg at        cg        cg |  a      g  |       gc a  a       cg        gc ta        gc        cg gt        gc        gc cg       |  t       gc tg       |  c       at gc        cg        cg ta        gc        at gt        cg        at                         ttttcttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [BQ] COG0123 Deacetylases, including yeast histone deacetylase and acetoin utilization protein ... can be seen here [L] COG1722 Exonuclease VII small subunit ... can be seen here     ..................................................................................................................