                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:67 nt.    Distance to gene:108 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-22.30 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=75 nt.     Delta G=-38.89 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGAca-taaaat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGAcaagtaatatcagggggctaaaatactcaatcgccgcacgggcttcaccaaaacccgatgaggcaacctcatcgggttttggtataaacatgg
atttcgggggcgccggcttgtccggcgcccttttctttttatatagctggtctgtctattcttttgccttttcatgcctgctgccgcgcaaaagctgctt
cactcttgccggacatattccagagcaaactgcaaaaccgggattacaATG

    BR0432 Gene: BR0432     GI: 23501333     BI number: BR0432     GOG: COG0586     Description: dedA family protei   a c  a gc gc at gc ta at gc cg cg cg at at at at cg cg at |  a |  t |  a |  a |  a |  c |  a |  t        t |  g      t  g |  g      c  t |  a       gc |  t       gc |  t       cg |  t       cg |  c       gc |  g       cg cg        gc tg        gc tg        gc cg        gt gc        gt |  g      c  t gc       t  | gc       t  | cg       t  | a  |       at cg        gc gc        gt             ttttatatagctggtctgtctattcttttgccttttcatgcctgctgccgcgcaaaagctgcttcactcttgccggacatattccagagcaaactgcaaaaccgggattacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0586 Uncharacterized membrane-associated protein ... can be seen here     ..................................................................................................................