                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCAAATATGCGGGCAGCGTTTATATCTGGTGGACCAAGGGTAAAACCGCGTCCCTTT
ATAACCTCATCGATAATCCCGAGGAGGATAAGCCTATAAGCTGCGTAGAACAGTGAtc
ccatgagtaaaccggggtgggctggccccggttcttttggcagtttcgctcgcaatttcttgtcgggggaagagaaaagctataaacccgatcaaaaggt
gtgaatgcggcgaaaacaaaaagaatgcggttccgggctgagagcagtgccgggcccgtctttgggggcggaattcggaacgagATG

    BR0441 Gene: BR0441     GI: 23501342     BI number: BR0441     GOG: COG1652     Description: LysM domain protei tc A  c Gc Ta Gt A  g C  a A  g A  t G  a A  a Ta Gc C  | Gc Tg        gc Cg       g  t G  g      g  g A  |       tg A  |       gc Tg        gc At        gc Tg        gc Cg        cg Cg        cg Gc        at             tcttttggcagtttcgctcgcaatttcttgtcgggggaagagaaaagctataaacccgatcaaaaggtgtgaatgcggcgaaaacaaaaagaatgcggttccgggctgagagcagtgccgggcccgtctttgggggcggaattcggaacgagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1652 Uncharacterized protein containing LysM domain ... can be seen here     ..................................................................................................................