                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-13.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATGTGGCGCTGTCGAATTCGTTCGGTTTCGGTGGCACCAATGCATCGCTGGTGCTG
CGCCGCTACACGGCCTGAcaggttcgcaaaaccgggtaatgataaaaacgcggggatttctccgcgtttttgccaaaataaaaccgg
atgcgatgtttaaaattgatggcacagtttagtgtggtagcgaatctggacggggcaggcccctccggcgaagcaaagtgcagaaagccgcttcgggcgc
aggcgatgaggctgcgccaatcgcgccgtggaggcaacaggaccgaggtgatggaGTG

    BR0462 Gene: BR0462     GI: 23501363     BI number: BR0462     GOG: COG1559     Description: conserved hypothetical protein TIGR0024   A T  C C  A GC CG CG GC |  C |  T |  G |  A |  c |  a |  g |  g |  t |  t |  c Cg Gc Ta C  a G  a Ta        at Gc       g  a Gc       t  a       tt |  g      a  a      a  t Tg       a  a       gc Cg        ta        gt G  t       gc        gc C  a      g  g       gc Ta        gc        cg At        cg        gc Cg        cg        cg                         tttttgccaaaataaaaccggatgcgatgtttaaaattgatggcacagtttagtgtggtagcgaatctggacggggcaggcccctccggcgaagcaaagtgcagaaagccgcttcgggcgcaggcgatgaggctgcgccaatcgcgccgtggaggcaacaggaccgaggtgatggaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1559 Predicted periplasmic solute-binding protein ... can be seen here     ..................................................................................................................