                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.90 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-18.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGGCTGCTATGCGGAAGTCATTCTGGAAGACGATCTTCTAAAGACGCTGCGCAACG
GCAAGGCGGCGACCTTCATCGTCTTCCAGACGCCGGAAGAAGGCGTGGGCATCCCGGT
AGACCTGAAGGGATTTGGCGAAGGCTTCGACGCCCTCCCCTGAttcacattcccgcagactgagaatg
ccacctttttcggctcgccatagcctgaatctccgtgcacagcggtgacatatggttgttctcaacggatttaaggcttacatcctgcaacagacatatg
ttgcaggatttattttATG

    BR0465 Gene: BR0465     GI: 23501366     BI number: BR0465     GOG: COG0312     Description: tldD protein, putativ   c a  a gt ta gt g  g cg gt at cg         g at       g  c |  t       at |  c       at |  t       ta c  c      t  c g  a       ta ta        at gc        gc        ca cg        gc       a  t cg       c  t      g  a ta       a  |       at c  t      a  |       cg t  t      c  |       at a  t      t  |       at a  a      c  |       cg g  |      t  |       gc ta        tg        ta cg        gc        cg cg        ta        cg gc        ta        ta at        gc        at                         ttattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0312 Predicted Zn-dependent proteases and their inactivated homologs ... can be seen here     ..................................................................................................................