                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCGCTTCGACCGGGCGGAAAGCGAAGCGCTGGCGGTCATCGACAATGCGCAGGACC
GCAAGGTTCTGGGGCTTTTGAGCGAAGCGCACACATTGCGCCGCTACAGCGAAGAACT
GGACCGCCGCCGCCGCGAAGTTGCCGGCGAAGTTTGAcgggcccatcataaaggtgtagctcatcgcccgtat
tttccggcccggtcgttccggcgattgccggtcgtcttttccctttcacgcattgccagacgggaggcccttcccgctggatcaaaatgcttcaacaaga
aggttacgcttATG

    BR0489 Gene: BR0489     GI: 23501390     BI number: BR0489     GOG: COG0637     Description: hydrolase, haloacid dehalogenase-like famil ct g  c a  a t  t gc tg         g gc       c  t gc       t  t a  c       gc a  g       gc at        cg ta        cg at       |  c |  t      |  g c  t      |  a t  t      |  t a  c      |  t c  c       cg cg        gc cg        gc gc        cg gc        cg             tcgtcttttccctttcacgcattgccagacgggaggcccttcccgctggatcaaaatgcttcaacaagaaggttacgcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0637 Predicted phosphatase/phosphohexomutase ... can be seen here     ..................................................................................................................