                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-18.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-14.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGCACTGCTGCAAATCGCGAAATTGGCCGGTTTTACACAGGAGTCCTTCGAGGCTT
GCTTGACGAACCAGCAACTTCTCAATGATGTGAGAGCAACGGTGGAACGTGGGTCGAA
GGAATTTGGTGTCAACGCGACGCCAACTTTCTTCATTAACGGGAAGAAATACGCGGGA
GACCTTTCGTTTGAGGAGATGTCGGGATTCATCGACAGCGCTCTTTGAtctgtttttcaggatg
aaaagcgggcgcttcatcgcgcccgttttctattttggcgtgcgtaatggaggggcttgctgATG

    BR0497 --- BR0498 Gene: BR0497     GI: 23501398     BI number: BR0497     GOG: COG1196     Description: SMC family protein Gene: BR0498     GI: 23501399     BI number: BR0498     GOG: COG1230     Description: cobalt-zinc-cadmium resistance protei   g g  a a  t cg ta ta ta ta tg gc t  | c  |       ca t  |      t  t A  |      t  c G  |       cg T  |       gc T  |       cg T  |       gc Cg        gc Tg        gc Cg        cg Gc        gt Cg        at Gc        at At        at             ctattttggcgtgcgtaatggaggggcttgctgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG1196 Chromosome segregation ATPases ... can be seen here [P] COG1230 Co/Zn/Cd efflux system component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:152 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G=-10.20 kcal/mol Antiterminator: Size=36 nt.     Delta G= -4.30 kcal/mol Anti-antiterminator:   Size=70 nt.     Delta G=-14.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCCGCACTGCTGCAAATCGCGAAATTGGCCGGTTTTACACAGGAGTCCTTCGAGGCTT GCTTGACGAACCAGCAACTTCTCAATGATGTGAGAGCAACGGTGGAACGTGGGTCGAA GGAATTTGGTGTCAACGCGACGCCAACTTTCTTCATTAACGGGAAGAAATACGCGGGA GACCTTTCGTTTGAGGAGATGTCGGGATTCATCGACAGCGCTCTTTGAtctgtttttcaggatg aaaagcgggcgcttcatcgcgcccgttttctattttggcgtgcgtaatggaggggcttgctgATG     BR0497 --- BR0498 Gene: BR0497     GI: 23501398     BI number: BR0497     GOG: COG1196     Description: SMC family protein Gene: BR0498     GI: 23501399     BI number: BR0498     GOG: COG1230     Description: cobalt-zinc-cadmium resistance protei GA T  T A  G AT CG TA CG TA T  | C  | A  | A  | CG GC |  A |  A A  C CG CG AT A  G G  G C  A       AA A  A      G  G G  C       CG T  |       TA T  |      G  A CG       G  T GT       G  T TG       T  T        C TG       G  G      A  G CG        CG       A  C GT        AT        CG G  |      A  G       TA A  |      G  T       GC GC        GC        TG CG        TA        GC TA       G  A       GC TA        GC        TA CG        CG        TA                         CTTTCTTCATTAACGGGAAGAAATACGCGGGAGACCTTTCGTTTGAGGAGATGTCGGGATTCATCGACAGCGCTCTTTGAtctgtttttcaggatgaaaagcgggcgcttcatcgcgcccgttttctattttggcgtgcgtaatggaggggcttgctgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG1196 Chromosome segregation ATPases ... can be seen here [P] COG1230 Co/Zn/Cd efflux system component ... can be seen here     ..................................................................................................................