                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCATGGGGGCGGGCTGGATGGCCTATCTGTTCGGCTTTGAAAAAGGCATCGCCTTCG
GCTTCGGCATTTTCATTGTGGGCGATCTTGTGAAGCTTGCCCTGGCTGCCATCGGTGT
GCCCGCCGTGACGGCGCTTGTGAAACGCTGAatcttttccgcatcctcgaaagccgggccccgtgcccggcttttca
tgttttgccggcttttcatgttttggttgaaactgcttcgcgattgacagcacgggcggggccgcgctttgtcagtgcagagattccaaaccttcgggga
gggtaatGTG

    BR0507 --- BR0508 Gene: BR0507     GI: 23501407     BI number: BR0507     GOG: COG3194     Description: ureidoglycolate hydrolase, putative Gene: BR0508     GI: 23501408     BI number: BR0508     GOG: COG2351     Description: conserved hypothetical protei            ct           t  t            at   G        At T  A       Gc GC       T  c CG        Cg CG        Gc GC       |  a CG       C  t |  C      A  c |  T      A  c        c C  T       At       c  g CG        Gc       c  t GT        Tg        cg |  G      G  a       gc |  A       Ta        gc |  A       Ta        gc TA        Cg        cg GC        Gc        cg TG       |  c       gc GC       |  g       at GT       |  g       at CG        Cg        at TA        Gc        gt                         catgttttgccggcttttcatgttttggttgaaactgcttcgcgattgacagcacgggcggggccgcgctttgtcagtgcagagattccaaaccttcggggagggtaatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG3194 Ureidoglycolate hydrolase ... can be seen here [R] COG2351 Transthyretin-like protein ... can be seen here     ..................................................................................................................