                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-16.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCTTTGAGCAAGGACGAAGAGCGAGTTTACTATCTGCAATCCGCATTGCGTGCCAT
TGACGCCCTACGGCCATTTCTTGAAACGCCAATCAAAGGCTTATGGTACGACAAGTGG
CCGGAAGGTGGTACGCTTATCGATGAGCCCGCGCCGGCATCGACCTTTTATCATATTC
TCTGTGCCTGTTATGAAGCAGAGAAAACAATATCAGAGCTTTAGgttgtggtgtcgaatttttggtt
gtcgccgctgatgatgacgatcagatgtgccgatgatgccgcatctgtattggagaaacATG

    BR0540 Gene: BR0540     GI: 23501429     BI number: BR0540     GOG: COG0438     Description: glycosyl transferase, group 1 family protei   C T  A A  A A  A       GA CG       G  A CG        CG GC        CG |  T       GT |  T      |  G |  A      |  G |  T      |  T C  G      |  A A  G       GC A  T       TG A  A       GC GC        AT        CG TG        AT       C  C TA       C  A       CG C  C       AT        GC TA        GC       |  C TA        CG       |  G TG       |  A      A  G AT       |  T       GC CG       |  G       TA CG       A  A       AT GC        TG        GC GC        GC        CG CG        GC        TA                         CCTTTTATCATATTCTCTGTGCCTGTTATGAAGCAGAGAAAACAATATCAGAGCTTTAGgttgtggtgtcgaatttttggttgtcgccgctgatgatgacgatcagatgtgccgatgatgccgcatctgtattggagaaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................