                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-16.10 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACATTCCTGCTCGATACGATCGTAGGGCTCATCTCGGTTGAACAGAACGCCATCATCA
AGATATTTTCCGTGGCTGCCGTCGGCTTCATGCCGCCAACACTTGTTGCATCCATCTA
TGGCATGAATTTTTCCTTCATGCCGGAACTGCACTCGCCCTGGGGTTATCCGATGGCG
CTGATATTCATGGTCGCCTCGGCCCTGCTGCCGCTGCTTTATTTCCGCAGCAAGGGGT
GGCTCTGAcaattctcgacaggcttcccctcccatgttatatcatctgtcataacatgggagaaagccATG

    BR0558 --- BR0557 Gene: BR0558     GI: 23501447     BI number: BR0558     GOG: NOG43329     Description: transcriptional regulator, AbrB family Gene: BR0557     GI: 23501446     BI number: BR0557     GOG: COG3654     Description: death-on-curing family protei   C C  C        T G  T      A  T CG       T  C TG       A  A CG       G  T A  |       TG CG        CG GT       |  T T  T       GC C  A       CG A  |       GC AT        GC GC       T  | GC        AT |  G       GC        TG |  A       CG       C  C |  T       CG       C  T CG       T  |       CG CG       A  |       GC GC       T  |       GC TG       T  |       CG |  C       GC       T  C AT        GC       C  T CG        GC        CG TA        GT        GC                         TTTATTTCCGCAGCAAGGGGTGGCTCTGAcaattctcgacaggcttcccctcccatgttatatcatctgtcataacatgggagaaagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3654 Prophage maintenance system killer protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:171 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-10.40 kcal/mol Antiterminator: Size=25 nt.     Delta G= -9.00 kcal/mol Anti-antiterminator:   Size=45 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACATTCCTGCTCGATACGATCGTAGGGCTCATCTCGGTTGAACAGAACGCCATCATCA AGATATTTTCCGTGGCTGCCGTCGGCTTCATGCCGCCAACACTTGTTGCATCCATCTA TGGCATGAATTTTTCCTTCATGCCGGAACTGCACTCGCCCTGGGGTTATCCGATGGCG CTGATATTCATGGTCGCCTCGGCCCTGCTGCCGCTGCTTTATTTCCGCAGCAAGGGGT GGCTCTGAcaattctcgacaggcttcccctcccatgttatatcatctgtcataacatgggagaaagccATG     BR0558 --- BR0557 Gene: BR0558     GI: 23501447     BI number: BR0558     GOG: NOG43329     Description: transcriptional regulator, AbrB family Gene: BR0557     GI: 23501446     BI number: BR0557     GOG: COG3654     Description: death-on-curing family protei   C                  CT T  A                A  T A  A                 CG CG                  AT TA                  AT AT                  CG C  A                |  C C  T                |  A G  T                |  T C  |        T       |  C AT       G  C      |  C AT        CG       |  A GC        CG       |  T A  C       GC       |  C CG       |  T      |  T AT       |  T      C  A |  G      |  C       GT A  G      |  A       CG G  C      T  T       CG T  T       CG        GC TG        GC        TA GC        GC        AT GC        TG        CG CG        GC        TA                         ATTTTTCCTTCATGCCGGAACTGCACTCGCCCTGGGGTTATCCGATGGCGCTGATATTCATGGTCGCCTCGGCCCTGCTGCCGCTGCTTTATTTCCGCAGCAAGGGGTGGCTCTGAcaattctcgacaggcttcccctcccatgttatatcatctgtcataacatgggagaaagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3654 Prophage maintenance system killer protein ... can be seen here     ..................................................................................................................