                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=2 nt.   Size=17 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGCTGCCGGTGCCGGCCAGTTCGGTTCGGGCTGGGCCTGGCTTTCCGTCAAGGACG
GCAAGCTTGAAATTTCCAAGACCCCGAACGGTGAAAACCCGCTCGTGCACGGTGCGGC
GCCGATCCTCGGCGTGGATGTGTGGGAACACTCCTATTACATCGATTACCGCAACGCG
CGTCCGAAATATCTCGAAGCTTTCGTCGATAGCCTCGTGAACTGGGATTACGTGCTGG
AAATGTACGAAAAGGCGGCATAAgcctgccgattgtttgaaaagcgcctgctctcaggggcttatataTTG

    BR0567 Gene: BR0567     GI: 23501456     BI number: BR0567     GOG: -------     Description: hypothetical protei   A T  C TG AT G  G GC GT TG CG |  A |  A |  A A  T A  G GT TA GC        TA CG       A  A TA        Cg |  A       Gc |  A       Gc |  A      |  t CG        Cg CG        Gc GC        Gc             gattgtttgaaaagcgcctgctctcaggggcttatataTTG     ..................................................................................................................