                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -5.19 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGACGTTCAACGTGTCCTACTCACTCTCGCAATATTCTTGCCCATGAAAGCCGATTTT
GAAAAACAGCCCTCCGGTTGGCTCCAGATTGCAGATGAGGCTTTAAAGAAACGATAAg
gtcagcccagcccaagcacttatctcgctttggggggccgctttttcacctatggtaaacagaaggtagcgatcccatcgccgcgcaaactacaggccat
ggaattggctggttacggaatcttttagaattcattggaaagtggaccgcagtttcaaaaaccgaaagcttgtacagacagggcATG

    BR0575 Gene: BR0575     GI: 23501464     BI number: BR0575     GOG: -------     Description: conserved hypothetical protei            ca           t  g            gc            gc           A  c           A  |           T  |           A  |           G  |           C  |           A  |           A  |           A  | AG       G  |        a C  A      A  |      t  t C  T      A  |      t  c T  T      A  |      c  t CG       T  |      a  c GC       T  |       cg G  A       Ta        gc TG        Cg       |  t TA        Gc        at GT        Gc        at G  |      A  |       cg C  |       Gc        cg CG        Ta        cg TA       A  a      g  | C  |      G  |      a  | CG       A  |       cg CG        Cg        cg GC        Gc        cg AT        Ta        gc                         cgctttttcacctatggtaaacagaaggtagcgatcccatcgccgcgcaaactacaggccatggaattggctggttacggaatcttttagaattcattggaaagtggaccgcagtttcaaaaaccgaaagcttgtacagacagggcATG     ..................................................................................................................