                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -4.61 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGGATCATgccctgtctgtacaagctttcggtttttgaaactgcggtccactttccaatgaattctaaaagattccgtaaccagccaattc
catggcctgtagtttgcgcggcgatgggatcgctaccttctgtttaccataggtgaaaaagcggccccccaaagcgagataagtgcttgggctgggctga
ccTTATCGTTTCTTTAAAGCCTCATCTGCAATCTGGAGCCAACCGGAGGGCTGTTTTT
CAAAATCGGCTTTCATGGGCAAGAATATTGCGAGAGTGAGTAGGACACGTTG

    BR0577 --- BR0578 --- BR0579 Gene: BR0577     GI: 23501466     BI number: BR0577     GOG: COG0642     Description: sensor histidine kinase Gene: BR0578     GI: 23501467     BI number: BR0578     GOG: COG3409     Description: peptidoglycan-binding protein, putative Gene: BR0579     GI: 23501468     BI number: BR0579     GOG: COG5447     Description: conserved hypothetical protei                      CC   t                 G  A a  a                A  A g  a                 GC a  g                 GC gt                  TG cg                  CG gc         G        TA a  |      C  T      A  | at       T  T      A  | at       A  T      C  | cg       T  C      G  | cg       T  T      T  | cg       c  T      C  | |  c      c  T      T  | |  t      a  A      A  | cg       g  A      C  | cg        tA        TG cg        cG        CG gc        gC        CG gt        gC        GC cg        gT        AT                         GTTTTTCAAAATCGGCTTTCATGGGCAAGAATATTGCGAGAGTGAGTAGGACACGTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here [M] COG3409 Putative peptidoglycan-binding domain-containing protein ... can be seen here [S] COG5447 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................