Gene putatively regulated by attenuation in B_suis_1330_I
Characteristics of the secondary structures
Terminator: Distance from promoter:69 nt. Distance to gene:135 nt. Distance to run of Ts=0 nt. Size=31 nt. Delta G=-20.20 kcal/mol
Antiterminator: Distance from promoter:51 nt. Size=32 nt. Delta G= -7.40 kcal/mol
Anti-antiterminator: Distance from promoter:24 nt. Size=43 nt. Delta G=-11.60 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgact-tagata. It has a score value of 77.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgactgcgttacggtgctttggtagatattggctacggtcgagaaattgcgactgatgccatcttagctacatacccccggctgacatggtaaggatag
ccccggaaagccatcggtttttcggggtttcttttagagaattccggctctcgaagggccgcatgtttcggcatcgacacccattacaattcatggatag
cacagttgaaaaccgggaaggggctggcgcagcggcacgaacgcatccgcctggcgtaccagctacagGTG
BR0584
Gene: BR0584 GI: 23501473 BI number: BR0584 GOG: ------- Description: hypothetical protei
ac
t c
a c
c c
a c ta
tg a g
cg gc t
gc gc a c
at a | cg
tg a | cg
ta t | gt
c c gc at
ta gc at
at tg at
cg a g gt
cg c a gc
gt a a cg
ta g | cg
a a ta cg
g | cg cg
tg gc gt
cg gc at
tcttttagagaattccggctctcgaagggccgcatgtttcggcatcgacacccattacaattcatggatagcacagttgaaaaccgggaaggggctggcgcagcggcacgaacgcatccgcctggcgtaccagctacagGTG
..................................................................................................................