                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-16.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGGACCGCATCGGCGTCCGCGTGCTGCGCGATCCTTATTCCGCCAAGCCCTATGTG
CTTTTTTACACCACCAAACGGGTGGGCGGCGGCGTACAGGATTTCGAGGCCATCAAGC
TTCTGAAATTTGCTGTCTGAaggcatccaactgtgacagcggttttgctgtcatttttctcaggttctttcaaccccctcctgcg
gtttttggcagctagtaacacgctcgaaagagggtgaatctttttgtggggttccatgcgtaactgactgatttgaaagttatcatctaggggaaagccA
TG

    BR0590 --- BR0591 --- BR0592 --- BR0593 Gene: BR0590     GI: 23501479     BI number: BR0590     GOG: NOG28222     Description: conserved hypothetical protein Gene: BR0591     GI: 23501480     BI number: BR0591     GOG: COG5614     Description: conserved hypothetical protein Gene: BR0592     GI: 23501481     BI number: BR0592     GOG: -------     Description: hypothetical protein Gene: BR0593     GI: 23501482     BI number: BR0593     GOG: NOG16553     Description: conserved hypothetical protei TC A  A C  A CG GC GT AT GC |  T CG TA        tc TA       a  c TA       c  a AT       g  a GT        gc G  |       at A  |      A  g       tt C  |      G  t      g  t A  |      T  |       gt T  |       Cg        cg GT        Ta        gc CG        Gc        at GC        Ta        cg GT        Cg        at CG        Gc        gc GT        Tg        ta GC        Tg        gt                         ttttctcaggttctttcaaccccctcctgcggtttttggcagctagtaacacgctcgaaagagggtgaatctttttgtggggttccatgcgtaactgactgatttgaaagttatcatctaggggaaagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5614 Bacteriophage head-tail adaptor ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-11.00 kcal/mol Antiterminator: Size=33 nt.     Delta G=-11.30 kcal/mol Anti-antiterminator:   Size=31 nt.     Delta G= -9.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGTGGACCGCATCGGCGTCCGCGTGCTGCGCGATCCTTATTCCGCCAAGCCCTATGTG CTTTTTTACACCACCAAACGGGTGGGCGGCGGCGTACAGGATTTCGAGGCCATCAAGC TTCTGAAATTTGCTGTCTGAaggcatccaactgtgacagcggttttgctgtcatttttctcaggttctttcaaccccctcctgcg gtttttggcagctagtaacacgctcgaaagagggtgaatctttttgtggggttccatgcgtaactgactgatttgaaagttatcatctaggggaaagccA TG     BR0590 --- BR0591 --- BR0592 --- BR0593 Gene: BR0590     GI: 23501479     BI number: BR0590     GOG: NOG28222     Description: conserved hypothetical protein Gene: BR0591     GI: 23501480     BI number: BR0591     GOG: COG5614     Description: conserved hypothetical protein Gene: BR0592     GI: 23501481     BI number: BR0592     GOG: -------     Description: hypothetical protein Gene: BR0593     GI: 23501482     BI number: BR0593     GOG: NOG16553     Description: conserved hypothetical protei            GC TC       T  T A  A      T  G C  A      T  T CG        AC GC        AT GT       A  G       tt AT       G  A      g  t GC       T  |       gt |  T       Ca        cg CG        Tg        gc TA        Tg        at TA        Cc        cg TA        Ga        at AT        At        gc GT        Ac        ta GT        Cc        gt                         ttttctcaggttctttcaaccccctcctgcggtttttggcagctagtaacacgctcgaaagagggtgaatctttttgtggggttccatgcgtaactgactgatttgaaagttatcatctaggggaaagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5614 Bacteriophage head-tail adaptor ... can be seen here     ..................................................................................................................