                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCGAACCTTGCAACAAAACCGGGCGAGATAACGCACtgcgcgtcatctaccccccccttcattccgcaagcg
tttttcagcccacatgtcgcacgaaagaatttaacaggaagaaccggaaaaatggcgacaaaccaccaatgcgggcatgaaaataacaataatgctagcc
gtgcgcgcagcacttctgcctgTTATATTACCAGTGTTTCCCAAGACTTGACGCTGAGCCTGATGAT
GTAAAGCGTTATGAACCAACATGAAAGCCGGGTTTTCCCGGCTTTTGTGCGTCCTGCC
GGGTG

    BR0630 Gene: BR0630     GI: 23501517     BI number: BR0630     GOG: COG1284     Description: conserved hypothetical protei CC A  A A  A GC TA AT TG TA |  A G  A CG GC A  | A  | A  | T  | G  | T  | A  | G  | T  | A  |       TT GC       T  T TG        GC CG        GC CG        GC GT        CG AT        CG GT        GC             TTTTGTGCGTCCTGCCGGGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1284 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................