                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-11.90 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-16.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGACGGCAGTTACGGCTAACGTTGCTTACGAACTGGTTCCTGGCTTCACCGTTACG
CCGGAAGTTTCCTACACCAAGTTTGGTGGCGAGTGGAAGAACACCGTTGCTGAAGACA
ATGCTTGGGGCGGTATCGTTCGCTTCCAGCGTTCGTTCTAAtccattacggattggatacagaaacccgg
cagaaataccgggttttttgttgccctcgtgcagcatcagatgcttgctttttatgctgaccgcagtctttctacaggggtcgcggaagatcgcctgaaa
cggagcaaagcagcATG

    BR0640 Gene: BR0640     GI: 23501527     BI number: BR0640     GOG: -------     Description: hypothetical protei             t           t  a           a  c TC        cg A  G       cg T  T       ta GT        At GC        At CG        Tg GC        Cg GT        Ta GT       |  t GC       |  a       aa T  C      T  c      g  a TA       G  a      a  t CG        Cg       c  a GC        Ta        gc TG        Ta        gc AT       G  a       cg AT       C  c       cg |  C      G  c       cg CG       A  c       at AT        Cg        at GT        Cg        at                         tttgttgccctcgtgcagcatcagatgcttgctttttatgctgaccgcagtctttctacaggggtcgcggaagatcgcctgaaacggagcaaagcagcATG     ..................................................................................................................