                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:161 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-25.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGAACTGCTGGCTGGCATTGAAGGCCTTGTCGCGCCGGAAAAGAACGACGGCTTCT
GAtcgttctatcagattgcaattcttcatgcgctgcggctttgctatgccgtagcgcatgtttttgtgcgcagatttttctgtgtattgttggaaatgc
ttgccggaaggaaatttctgtaggaaattgatcctattggcagaaagattgctcaaggatcgtgagatattcgtttttttacgattcctgatcaaaatgg
ccgatatctctgtatgtgttttggttcgagggagtttcggcagATG

    BR0652 --- pyrE Gene: BR0652     GI: 23501539     BI number: BR0652     GOG: COG0317     Description: RelA/SpoT family protein Gene: pyrE     GI: 23501540     BI number: BR0653     GOG: COG0461     Description: orotate phosphoribosyltransferas gc t  t t  a t  t cg gc gc cg gt        tt ta       t  t cg       g  t gc        tg cg        at gc        cg ta        gc at        cg cg        gc             agatttttctgtgtattgttggaaatgcttgccggaaggaaatttctgtaggaaattgatcctattggcagaaagattgctcaaggatcgtgagatattcgtttttttacgattcctgatcaaaatggccgatatctctgtatgtgttttggttcgagggagtttcggcagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0317 Guanosine polyphosphate pyrophosphohydrolases/synthetases ... can be seen here [F] COG0461 Orotate phosphoribosyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_I                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:177 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-25.60 kcal/mol                                                                         Nomenclature/Definitions GAAGAACTGCTGGCTGGCATTGAAGGCCTTGTCGCGCCGGAAAAGAACGACGGCTTCT GAtcgttctatcagattgcaattcttcatgcgctgcggctttgctatgccgtagcgcatgtttttgtgcgcagatttttctgtgtattgttggaaatgc ttgccggaaggaaatttctgtaggaaattgatcctattggcagaaagattgctcaaggatcgtgagatattcgtttttttacgattcctgatcaaaatgg ccgatatctctgtatgtgttttggttcgagggagtttcggcagATG     BR0652 --- pyrE Gene: BR0652     GI: 23501539     BI number: BR0652     GOG: COG0317     Description: RelA/SpoT family protein Gene: pyrE     GI: 23501540     BI number: BR0653     GOG: COG0461     Description: orotate phosphoribosyltransferas           gc          t  t          t  a          t  t           cg           gc           gc           cg           gt           ta           cg           gc           cg           gc           ta           at           cg             tttttgtgcgcagatttttctgtgtattgttggaaatgcttgccggaaggaaatttctgtaggaaattgatcctattggcagaaagattgctcaaggatcgtgagatattcgtttttttacgattcctgatcaaaatggccgatatctctgtatgtgttttggttcgagggagtttcggcagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0317 Guanosine polyphosphate pyrophosphohydrolases/synthetases ... can be seen here [F] COG0461 Orotate phosphoribosyltransferase ... can be seen here     ..................................................................................................................