                                                                        Gene putatively regulated by attenuation in B_suis_1330_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-12.55 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGATGCAGTATATGACGCCGACCATGCTGTTTTTCTTCGCCATATTCATCTTCCATG
AACCGTTCTCGACGGCGCAGCTTGCAGCATTCTTGCTCATATGGGCGGGACTGGCGCT
CTACACATGGTCTTCGCTTTCCCAGCACAGGCGCAACCGCGCGCAGGCCTGAatatttgat
gcgaagatggttaatctccggtggatatctgccggagtgacatattttggccgctctatccccgttaggtccaagaagtcttattcttacaggacgatca
agcggttggcggagaaaacacggATG

    BR0681 Gene: BR0681     GI: 23501568     BI number: BR0681     GOG: COG0739     Description: peptidase, M23/M37 famil CG C  C A  G A  C CG GC |  A |  G        t CG       g  t GC       g  a GC        ta        ta AT        at       a  t CG        gc        gc A  A       at        gt C  a      a  c       tg G  t       gc        gc A  a       cg        gc C  t      g  g       cg C  t      t  |       cg C  t      a  |       ta T  g       gt        cg T  a       tg       t  | T  t       tg       a  | Cg        ta        at Gc        at        tg Cg        ta        ta Ta        at        gc                         atattttggccgctctatccccgttaggtccaagaagtcttattcttacaggacgatcaagcggttggcggagaaaacacggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0739 Membrane proteins related to metalloendopeptidases ... can be seen here     ..................................................................................................................